Skip to main content
Addgene

pClgn-Lrrc23-1D4
(Plasmid #179922)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179922 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pClgn-FLAG
  • Backbone size w/o insert (bp) 3803
  • Total vector size (bp) 4823
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lrrc23
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1020
  • Mutation
    Stop codon removed
  • GenBank ID
    NM_001302555.1 NM_001302555.1
  • Entrez Gene
    Lrrc23 (a.k.a. 4921537K05Rik, B7, Lrpb7)
  • Promoter Calmegin
  • Tag / Fusion Protein
    • 1D4 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer TTGAGCGGGCCGCTTGCGCACTGG
  • 3′ sequencing primer GCCACACCAGCCACCACCTTCTG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pClgn-Lrrc23-1D4 was a gift from Masahito Ikawa (Addgene plasmid # 179922 ; http://n2t.net/addgene:179922 ; RRID:Addgene_179922)

  • For your References section:

    LRRC23 is a conserved component of the radial spoke that is necessary for sperm motility and male fertility in mice. Zhang X, Sun J, Lu Y, Zhang J, Shimada K, Noda T, Zhao S, Koyano T, Matsuyama M, Zhou S, Wu J, Ikawa M, Liu M. J Cell Sci. 2021 Oct 15;134(20). pii: 272563. doi: 10.1242/jcs.259381. Epub 2021 Oct 21. 10.1242/jcs.259381 PubMed 34585727
Related items: