pX459-sg-tdTomato166/892
(Plasmid
#179919)
-
PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 166 and 892.
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179919 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX459
-
Backbone manufacturerDr. Feng Zhang Lab
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametdTomato sgRNA
-
Alt nametandem dimer Tomato single guide RNA
-
gRNA/shRNA sequenceatgtcccaggcgaagggcag
-
SpeciesSynthetic
-
Insert Size (bp)21
- Promoter U6
-
Tags
/ Fusion Proteins
- 3XFLAG (N terminal on insert)
- 2A-Puro (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was cloned with the one step BbsI restriction enzyme cloning method. Please note that gRNA sequences that do not start with a G, need a G added to the sequence before cloning for U6 promoter transcription.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX459-sg-tdTomato166/892 was a gift from Indeever Madireddy & Johan Sosa (Addgene plasmid # 179919 ; http://n2t.net/addgene:179919 ; RRID:Addgene_179919) -
For your References section:
Stably Integrating an Inducible CRISPR-Cas9 to Protect Against Viral Infections in Vitro. Madireddy I, Pierson Smela M. MicroPubl Biol. 2022 Jun 16;2022. doi: 10.17912/micropub.biology.000590. eCollection 2022. 10.17912/micropub.biology.000590 PubMed 35789697