Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pX459-sg-tdTomato166/892
(Plasmid #179919)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179919 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX459
  • Backbone manufacturer
    Dr. Feng Zhang Lab
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tdTomato sgRNA
  • Alt name
    tandem dimer Tomato single guide RNA
  • gRNA/shRNA sequence
    atgtcccaggcgaagggcag
  • Species
    Synthetic
  • Insert Size (bp)
    21
  • Promoter U6
  • Tags / Fusion Proteins
    • 3XFLAG (N terminal on insert)
    • 2A-Puro (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was cloned with the one step BbsI restriction enzyme cloning method. Please note that gRNA sequences that do not start with a G, need a G added to the sequence before cloning for U6 promoter transcription.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX459-sg-tdTomato166/892 was a gift from Indeever Madireddy & Johan Sosa (Addgene plasmid # 179919 ; http://n2t.net/addgene:179919 ; RRID:Addgene_179919)
  • For your References section:

    Stably Integrating an Inducible CRISPR-Cas9 to Protect Against Viral Infections in Vitro. Madireddy I, Pierson Smela M. MicroPubl Biol. 2022 Jun 16;2022. doi: 10.17912/micropub.biology.000590. eCollection 2022. 10.17912/micropub.biology.000590 PubMed 35789697