pX459-sg-tdTomato90/816
(Plasmid #179918)

• Purpose: Double cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 90 and 816.
• Depositing Labs: Indeever Madireddy, Johan Sosa
• Publication: Madireddy et al MicroPubl Biol. 2022 Jun 16;2022. doi: 10.17912/micropub.biology.000590. eCollection 2022.

Backbone

• Vector backbone: pX459
• Backbone manufacturer: Dr. Feng Zhang Lab
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: tdTomato sgRNA
• Alt name: tandem dimer Tomato single guide RNA
• gRNA/shRNA sequence: ggccacgagttcgagatcga
• Species: Synthetic
• Insert Size (bp): 20
• Promoter: U6
• Tags / Fusion Proteins:
  • 3XFLAG (N terminal on insert)
  • 2A-Puro (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: GACTATCATATGCTTACCGT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid was cloned with the one step BbsI restriction enzyme cloning method. Please note that gRNA sequences that do not start with a G, need a G added to the sequence before cloning for U6 promoter transcription.