pENTR1A-TAZ S89A
(Plasmid
#179911)
-
PurposeEntry vector of TAZ S89A for gateway coloning.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179911 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepENTR1A
-
Backbone manufacturerInvitrogen
- Total vector size (bp) 2700
-
Vector typeEntry Vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameWW Domain Containing Transcription Regulator 1
-
Alt nameWWTR1
-
Alt nameTranscriptional Coactivator With PDZ-Binding Motif
-
Alt nameTAZ
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1200
-
MutationSerine 89 mutated to Alanine
-
GenBank ID25937
-
Entrez GeneWWTR1 (a.k.a. TAZ)
-
Tag
/ Fusion Protein
- 3X Flag-tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CTACAAACTCTTCCTGTTAGTTA
- 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTAZ S89A was cloned from Addgene plasmid #24815: 3XFlag pCMV5-TOPO TAZ (S89A)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR1A-TAZ S89A was a gift from Xin Chen (Addgene plasmid # 179911 ; http://n2t.net/addgene:179911 ; RRID:Addgene_179911) -
For your References section:
TAZ is indispensable for c-MYC-induced hepatocarcinogenesis. Wang H, Zhang S, Zhang Y, Jia J, Wang J, Liu X, Zhang J, Song X, Ribback S, Cigliano A, Evert M, Liang B, Wu H, Calvisi DF, Zeng Y, Chen X. J Hepatol. 2021 Aug 28. pii: S0168-8278(21)02016-X. doi: 10.1016/j.jhep.2021.08.021. 10.1016/j.jhep.2021.08.021 PubMed 34464659