Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pENTR1A-TAZ S89A
(Plasmid #179911)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179911 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pENTR1A
  • Backbone manufacturer
    Invitrogen
  • Total vector size (bp) 2700
  • Vector type
    Entry Vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    WW Domain Containing Transcription Regulator 1
  • Alt name
    WWTR1
  • Alt name
    Transcriptional Coactivator With PDZ-Binding Motif
  • Alt name
    TAZ
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1200
  • Mutation
    Serine 89 mutated to Alanine
  • GenBank ID
    25937
  • Entrez Gene
    WWTR1 (a.k.a. TAZ)
  • Tag / Fusion Protein
    • 3X Flag-tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CTACAAACTCTTCCTGTTAGTTA
  • 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    TAZ S89A was cloned from Addgene plasmid #24815: 3XFlag pCMV5-TOPO TAZ (S89A)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR1A-TAZ S89A was a gift from Xin Chen (Addgene plasmid # 179911 ; http://n2t.net/addgene:179911 ; RRID:Addgene_179911)
  • For your References section:

    TAZ is indispensable for c-MYC-induced hepatocarcinogenesis. Wang H, Zhang S, Zhang Y, Jia J, Wang J, Liu X, Zhang J, Song X, Ribback S, Cigliano A, Evert M, Liang B, Wu H, Calvisi DF, Zeng Y, Chen X. J Hepatol. 2021 Aug 28. pii: S0168-8278(21)02016-X. doi: 10.1016/j.jhep.2021.08.021. 10.1016/j.jhep.2021.08.021 PubMed 34464659