pJET-59-DExCon-mTagBFP2-R25
(Plasmid
#179900)
-
PurposeDonor with homologous arms for Rab25 to knock in DExCon-mTagBFP2 module
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179900 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJet1.2
-
Backbone manufacturerThermo Scientific
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 5044
-
Vector typeMammalian Expression, Bacterial Expression, CRISPR ; Donor for homologous based knock in
-
Selectable markersmTagBFP2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRAB25, member RAS oncogene family
-
Alt nameCATX-8
-
Alt nameRAB11C
-
SpeciesH. sapiens (human)
-
Entrez GeneRAB25 (a.k.a. CATX-8, RAB11C)
- Promoter TRE3GS
-
Tag
/ Fusion Protein
- mTagBFP2 (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGACTCACTATAGGGAGAGCG
- 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Here donor for DExCon Rab25 knock in. DExCon = Doxycycline-mediated endogenous gene Expression Control. Lentiviral delivery of TetOn 3G is also required for this to work.
Please visit https://www.biorxiv.org/content/10.1101/2021.12.03.471086v1.full for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJET-59-DExCon-mTagBFP2-R25 was a gift from Patrick Caswell (Addgene plasmid # 179900 ; http://n2t.net/addgene:179900 ; RRID:Addgene_179900) -
For your References section:
On demand expression control of endogenous genes with DExCon, DExogron and LUXon reveals differential dynamics of Rab11 family members. Gemperle J, Harrison TS, Flett C, Adamson AD, Caswell PT. Elife. 2022 Jun 16;11. pii: 76651. doi: 10.7554/eLife.76651. 10.7554/eLife.76651 PubMed 35708998