pJET-63-SFFV-T2A-BlaR-polyA-R11a
(Plasmid
#179894)
-
PurposeDonor with homologous arms for Rab11a to knock in SFFV-T2A-Blasticidin resistance-PolyA cassette (for knock out)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179894 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJet1.2
-
Backbone manufacturerThermo Scientific
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 4897
-
Vector typeMammalian Expression, Bacterial Expression, CRISPR ; Donor for homologous based knock in
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRAB11A, member RAS oncogene family
-
Alt nameYL8
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1898
-
Entrez GeneRAB11A (a.k.a. YL8)
- Promoter SFFV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGACTCACTATAGGGAGAGCG
- 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Here donor for integration of SFFV-T2A-Blasticidine resistance-PolyA cassette (for knock out) to Rab11a locus
This can be combined with knock in of DExCon module to be able to reversibly rescue Rab11a expression (from the second allele) on demand
DExCon = Doxycycline-mediated endogenous gene Expression Control
Please visit https://www.biorxiv.org/content/10.1101/2021.12.03.471086v1.full for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJET-63-SFFV-T2A-BlaR-polyA-R11a was a gift from Patrick Caswell (Addgene plasmid # 179894 ; http://n2t.net/addgene:179894 ; RRID:Addgene_179894) -
For your References section:
On demand expression control of endogenous genes with DExCon, DExogron and LUXon reveals differential dynamics of Rab11 family members. Gemperle J, Harrison TS, Flett C, Adamson AD, Caswell PT. Elife. 2022 Jun 16;11. pii: 76651. doi: 10.7554/eLife.76651. 10.7554/eLife.76651 PubMed 35708998