pUC57-fsr1
(Plasmid #179866)

• Purpose: Encodes the polyketide synthase Fsr1 from Fusarium vanettenii codon optimized for expression in Saccharomyces cerevisiae
• Depositing Lab: Jens Laurids Sørensen
• Publication: Bejenari et al J Microbiol Biol Educ. 2023 Nov 27;24(3):e00242-22. doi: 10.1128/jmbe.00242-22. eCollection 2023 Dec.

Backbone

• Vector backbone: pUC57
• Backbone manufacturer: Genscript
• Backbone size w/o insert (bp): 2710
• Total vector size (bp): 9607
• Modifications to backbone: -
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Fusarubin polyketide synthase
• Alt name: fsr1
• Alt name: PKS3
• Species: Fusarium vanettenii 77-13-4
• Insert Size (bp): 6897
• Mutation: Codon optimized for expression in Saccharomyces cerevisiae
• GenBank ID: NECHADRAFT_101778 EEU34216.1

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: cccagtcacgacgttgtaaaacg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Gene insert was synthesized by Genscript

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry