Skip to main content
Addgene

AAVS1-PuroR Xlone eGFP
(Plasmid #179837)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179837 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Addgene #136936
  • Backbone size w/o insert (bp) 9657
  • Total vector size (bp) 10374
  • Vector type
    Mammalian Expression, CRISPR, TALEN, Synthetic Biology ; Donor plasmid
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eGFP
  • Species
    Synthetic
  • Insert Size (bp)
    717
  • Promoter TRE3GS

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer gcgcctataaaagagtgctga
  • 3′ sequencing primer cgcctgtcttaggttggagt
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that this plasmid is identical to Addgene plasmid # 136936 except it does not contain the WPRE sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-PuroR Xlone eGFP was a gift from Xiaoping Bao (Addgene plasmid # 179837 ; http://n2t.net/addgene:179837 ; RRID:Addgene_179837)

  • For your References section:

    Temporal Expression of Transcription Factor ID2 Improves Natural Killer Cell Differentiation from Human Pluripotent Stem Cells. Jung J, Chang Y, Jin G, Lian X, Bao X. ACS Synth Biol. 2022 May 24. doi: 10.1021/acssynbio.2c00017. 10.1021/acssynbio.2c00017 PubMed 35608547
Related items: