pJH2028
(Plasmid
#179771)
-
PurposePnlf-1::NLF::2XGFP unc-54 3'UTR C.elegans neural expression of NLF::2XGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179771 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepBSK
-
Backbone manufacturerstratagene
- Backbone size w/o insert (bp) 5089
- Total vector size (bp) 10406
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLF-1::2XGFP
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)5317
-
GenBank ID
-
Entrez Genenlf-1 (a.k.a. CELE_F55A4.2)
- Promoter nlf-1
-
Tag
/ Fusion Protein
- 2XGFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer ATGCGGCCTCGCACGCCTTA
- 3′ sequencing primer CTATAACAACAACATA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note Addgene NGS found some differences in genomic sequence of NLF-1. Depositor confirms this does not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJH2028 was a gift from Mei Zhen (Addgene plasmid # 179771 ; http://n2t.net/addgene:179771 ; RRID:Addgene_179771) -
For your References section:
NLF-1 delivers a sodium leak channel to regulate neuronal excitability and modulate rhythmic locomotion. Xie L, Gao S, Alcaire SM, Aoyagi K, Wang Y, Griffin JK, Stagljar I, Nagamatsu S, Zhen M. Neuron. 2013 Mar 20;77(6):1069-82. doi: 10.1016/j.neuron.2013.01.018. 10.1016/j.neuron.2013.01.018 PubMed 23522043