Skip to main content
Addgene

pMXs-hOCT4 (Plath)
(Plasmid #17964)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 17964 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMXs
  • Backbone size w/o insert (bp) 4622
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    none

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    POU domain, class 5, transcription factor 1
  • Alt name
    OCT4
  • Alt name
    POU5F1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1084
  • Mutation
    N/A
  • Entrez Gene
    POU5F1 (a.k.a. OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site Not I (not destroyed)
  • 5′ sequencing primer cctctagactgccggatctagcta
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pMXs is originally from Dr. Toshio Kitamura of the University of Tokyo, the Institute of Medical Science. If you use this plasmid in a paper, please cite: Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics. Exp Hematol. 2003 Nov;31(11):1007-14. Kitamura T, Koshino Y, Shibata F, Oki T, Nakajima H, Nosaka T, Kumagai H.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXs-hOCT4 (Plath) was a gift from Kathrin Plath (Addgene plasmid # 17964 ; http://n2t.net/addgene:17964 ; RRID:Addgene_17964)
  • For your References section:

    Generation of human induced pluripotent stem cells from dermal fibroblasts. Lowry WE, Richter L, Yachechko R, Pyle AD, Tchieu J, Sridharan R, Clark AT, Plath K. Proc Natl Acad Sci U S A. 2008 Feb 26. 105(8):2883-8. 10.1073/pnas.0711983105 PubMed 18287077