pMXs-hOCT4 (Plath)
(Plasmid #17964)

• Depositing Lab: Kathrin Plath
• Publication: Lowry et al Proc Natl Acad Sci U S A. 2008 Feb 26. 105(8):2883-8.

Backbone

• Vector backbone: pMXs
• Backbone size w/o insert (bp): 4622
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: none

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: POU domain, class 5, transcription factor 1
• Alt name: OCT4
• Alt name: POU5F1
• Species: H. sapiens (human)
• Insert Size (bp): 1084
• Mutation: N/A
• Entrez Gene: POU5F1 (a.k.a. OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: Not I (not destroyed)
• 5′ sequencing primer: cctctagactgccggatctagcta

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pMXs is originally from Dr. Toshio Kitamura of the University of Tokyo, the Institute of Medical Science. If you use this plasmid in a paper, please cite: Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics. Exp Hematol. 2003 Nov;31(11):1007-14. Kitamura T, Koshino Y, Shibata F, Oki T, Nakajima H, Nosaka T, Kumagai H.
• Articles Citing this Plasmid:
  • 9 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry