pJH3577
(Plasmid
#179612)
-
PurposePceh-12::Chrimson::Cherry unc-54 3' UTR C.elegans VB-MNs expression of Chrimson::Cherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179612 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBSK
-
Backbone manufacturerstratagene
- Backbone size w/o insert (bp) 7129
- Total vector size (bp) 8340
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChrimson
-
Insert Size (bp)1211
-
GenBank ID
- Promoter Pceh-12
-
Tag
/ Fusion Protein
- Cherry (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer ATGGCTGAGCTCATCTCCT
- 3′ sequencing primer GGTACCGCGACGGTGTCCTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJH3577 was a gift from Mei Zhen (Addgene plasmid # 179612 ; http://n2t.net/addgene:179612 ; RRID:Addgene_179612) -
For your References section:
Excitatory motor neurons are local oscillators for backward locomotion. Gao S, Guan SA, Fouad AD, Meng J, Kawano T, Huang YC, Li Y, Alcaire S, Hung W, Lu Y, Qi YB, Jin Y, Alkema M, Fang-Yen C, Zhen M. Elife. 2018 Jan 23;7. pii: 29915. doi: 10.7554/eLife.29915. 10.7554/eLife.29915 PubMed 29360035