Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJH3558
(Plasmid #179611)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179611 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBSK
  • Backbone manufacturer
    stratagene
  • Backbone size w/o insert (bp) 6771
  • Total vector size (bp) 7982
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Chrimson
  • Insert Size (bp)
    1211
  • GenBank ID
  • Promoter Punc-4
  • Tag / Fusion Protein
    • Cherry (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer ATGGCTGAGCTCATCTCCT
  • 3′ sequencing primer GGTACCGCGACGGTGTCCTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJH3558 was a gift from Mei Zhen (Addgene plasmid # 179611 ; http://n2t.net/addgene:179611 ; RRID:Addgene_179611)
  • For your References section:

    Excitatory motor neurons are local oscillators for backward locomotion. Gao S, Guan SA, Fouad AD, Meng J, Kawano T, Huang YC, Li Y, Alcaire S, Hung W, Lu Y, Qi YB, Jin Y, Alkema M, Fang-Yen C, Zhen M. Elife. 2018 Jan 23;7. pii: 29915. doi: 10.7554/eLife.29915. 10.7554/eLife.29915 PubMed 29360035