p300 core-dCas9-CBP core
(Plasmid #179559)

• Purpose: encodes S. pyogenes dCas9 with n-terminal fusion of human p300 core (aa 1048-1664) and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoter
• Depositing Lab: Isaac Hilton
• Publication: Wang et al Nucleic Acids Res. 2022 Aug 12;50(14):7842-7855. doi: 10.1093/nar/gkac582.

Backbone

• Vector backbone: LentiCRISPR v2
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: S. pyogenes dCas9 with n-terminal fusion of human p300 core (aa 1048-1664) & c-terminal fusion of human CBP core (aa 1084-1701)
• Species: H. sapiens (human)
• Insert Size (bp): 7911
• Mutation: D10A; H840A in S.pyogenes Cas9
• Entrez Gene: CREBBP (a.k.a. CBP, KAT3A, MKHK1, RSTS, RSTS1)
• Entrez Gene: EP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
• Promoter: EF-1alpha
• Tag / Fusion Protein:
  • Flag Tag (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATCCGGTGCCTAGAGAAGGT

Resource Information

• Supplemental Documents:
  • p300 core-dCas9-CBP core.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry