dCas9-p300 HAT
(Plasmid #179544)

• Purpose: encodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT domain (aa 1287-1664) driven by AF4 promoter
• Depositing Lab: Isaac Hilton
• Publication: Wang et al Nucleic Acids Res. 2022 Aug 12;50(14):7842-7855. doi: 10.1093/nar/gkac582.

Backbone

• Vector backbone: LentiCRISPR v2
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: S. pyogenes dCas9 with c-terminal fusion of human p300 HAT domain (aa 1287-1664)
• Species: H. sapiens (human)
• Insert Size (bp): 5292
• Mutation: D10A; H840A in S.pyogenes Cas9
• Entrez Gene: EP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
• Promoter: EF-1alpha
• Tag / Fusion Protein:
  • Flag Tag (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATCCGGTGCCTAGAGAAGGT

Resource Information

• Supplemental Documents:
  • dCas9-p300 HAT.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry