Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-EF1a-4mtGCaMP6f-DIO
(Plasmid #179529)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179529 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-EF1a-double floxed-mCherry-WPRE-HGHpA
  • Backbone manufacturer
    Karl Deisseroth
  • Backbone size w/o insert (bp) 5604
  • Total vector size (bp) 7362
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    4mtGCaMP6f
  • Species
    Synthetic
  • Insert Size (bp)
    1758
  • Promoter Ef1a
  • Tag / Fusion Protein
    • 4x Cox8 targeting sequence (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (destroyed during cloning)
  • 3′ cloning site NheI (destroyed during cloning)
  • 5′ sequencing primer GGATTGTAGCTGCTATTAGC
  • 3′ sequencing primer GGCAAATAACTTCGTATAGGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The plasmid from which 4mtGCaMP6f was derived was generously gifted by Diego de Stefani

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2022.04.07.487496 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1a-4mtGCaMP6f-DIO was a gift from Maarten Kole (Addgene plasmid # 179529 ; http://n2t.net/addgene:179529 ; RRID:Addgene_179529)
  • For your References section:

    Parvalbumin basket cell myelination accumulates axonal mitochondria to internodes. Kole K, Voesenek BJB, Brinia ME, Petersen N, Kole MHP. Nat Commun. 2022 Dec 9;13(1):7598. doi: 10.1038/s41467-022-35350-x. 10.1038/s41467-022-35350-x PubMed 36494349