pAAV-EF1a-4mtGCaMP6f-DIO
(Plasmid
#179529)
-
PurposeCre-dependent expression of mitochondria-targeted GCaMP6f under control of the EF1a promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179529 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-EF1a-double floxed-mCherry-WPRE-HGHpA
-
Backbone manufacturerKarl Deisseroth
- Backbone size w/o insert (bp) 5604
- Total vector size (bp) 7362
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name4mtGCaMP6f
-
SpeciesSynthetic
-
Insert Size (bp)1758
- Promoter Ef1a
-
Tag
/ Fusion Protein
- 4x Cox8 targeting sequence (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (destroyed during cloning)
- 3′ cloning site NheI (destroyed during cloning)
- 5′ sequencing primer GGATTGTAGCTGCTATTAGC
- 3′ sequencing primer GGCAAATAACTTCGTATAGGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe plasmid from which 4mtGCaMP6f was derived was generously gifted by Diego de Stefani
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.04.07.487496 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1a-4mtGCaMP6f-DIO was a gift from Maarten Kole (Addgene plasmid # 179529 ; http://n2t.net/addgene:179529 ; RRID:Addgene_179529) -
For your References section:
Parvalbumin basket cell myelination accumulates axonal mitochondria to internodes. Kole K, Voesenek BJB, Brinia ME, Petersen N, Kole MHP. Nat Commun. 2022 Dec 9;13(1):7598. doi: 10.1038/s41467-022-35350-x. 10.1038/s41467-022-35350-x PubMed 36494349