XLone-BSD SPI1
(Plasmid #179514)

• Purpose: Tunable and temporal expression control of SPI1
• Depositing Lab: Xiaoping Bao
• Publication: Jung et al ACS Synth Biol. 2022 May 24. doi: 10.1021/acssynbio.2c00017.

Backbone

• Vector backbone: Addgene # 96930
• Backbone size w/o insert (bp): 5549
• Total vector size (bp): 6419
• Vector type: Mammalian Expression, Synthetic Biology
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SPI1
• Alt name: OF
• Alt name: PU.1
• Alt name: SFPI1, SPI-1, SPI-A
• Species: H. sapiens (human)
• Insert Size (bp): 813
• Entrez Gene: SPI1 (a.k.a. AGM10, OF, PU.1, SFPI1, SPI-1, SPI-A)
• Promoter: TRE3GS Promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: gcgcctataaaagagtgctga
• 3′ sequencing primer: cgcctgtcttaggttggagt

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Human SPI1 was cloned from Addgene plasmid #97039, a gift from George Daley Lab.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry