pSSa29
(Plasmid
#179503)
-
PurposeTet-on red-shifted luciferase expression
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179503 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepCgACU-5
-
Selectable markersSAT1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRed-shifted luciferase
-
Alt nameCgLUCopt-mut2
-
SpeciesSynthetic
-
Insert Size (bp)1653
- Promoter Tet-HOP1 (p98CGH)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCTCTTATTGACCACACCT
- 3′ sequencing primer CAGGGCCCTTCTTAATGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSSa29 was a gift from Dominique Sanglard (Addgene plasmid # 179503 ; http://n2t.net/addgene:179503 ; RRID:Addgene_179503) -
For your References section:
A novel Candida glabrata doxycycline-inducible system for in vitro/in vivo use. Schrevens S, Sanglard D. FEMS Yeast Res. 2022 Sep 24;22(1):foac046. doi: 10.1093/femsyr/foac046. 10.1093/femsyr/foac046 PubMed 36047937
Map uploaded by the depositor.
