Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLentiCrisprV2 sgRNA hPER2c-term #3
(Plasmid #179456)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179456 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Zhang lab, addgene #52961
  • Backbone size w/o insert (bp) 14873
  • Total vector size (bp) 13013
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Only amplify in RecA- bacteria
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting human PER2
  • gRNA/shRNA sequence
    GGCAGCCAGCGAGGTACACC
  • Species
    H. sapiens (human)
  • GenBank ID
    8864
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • 3′ sequencing primer --
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Designed to be used with Addgene #179448-179452

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCrisprV2 sgRNA hPER2c-term #3 was a gift from Achim Kramer (Addgene plasmid # 179456 ; http://n2t.net/addgene:179456 ; RRID:Addgene_179456)
  • For your References section:

    Live-cell imaging of circadian clock protein dynamics in CRISPR-generated knock-in cells. Gabriel CH, Del Olmo M, Zehtabian A, Jager M, Reischl S, van Dijk H, Ulbricht C, Rakhymzhan A, Korte T, Koller B, Grudziecki A, Maier B, Herrmann A, Niesner R, Zemojtel T, Ewers H, Granada AE, Herzel H, Kramer A. Nat Commun. 2021 Jun 18;12(1):3796. doi: 10.1038/s41467-021-24086-9. 10.1038/s41467-021-24086-9 PubMed 34145278