pGEX6P1-hPREP
(Plasmid #179387)

• Purpose: Express human prolyl oligopeptidase (tagged) in bacterial cells
• Depositing Lab: Christian Gruber
• Publication: Retzl et al J Nat Prod. 2020 Nov 25;83(11):3305-3314. doi: 10.1021/acs.jnatprod.0c00648. Epub 2020 Oct 29.

Backbone

• Vector backbone: pGEX6P-1
• Backbone size w/o insert (bp): 4984
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: human prolyl oligopeptidase
• Alt name: POP
• Alt name: PREP
• Species: H. sapiens (human)
• Insert Size (bp): 2133
• GenBank ID: NM_002726.4
• Promoter: TAC
• Tag / Fusion Protein:
  • GST (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: GGGCTGGCAAGCCACGTTTGGTG
• 3′ sequencing primer: GGAGCTGCATGTGTCAGAGG

Resource Information

• Supplemental Documents:
  • pGEX-6P-1_human PREP

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry