pGEX6P1-hPREP
(Plasmid
#179387)
-
PurposeExpress human prolyl oligopeptidase (tagged) in bacterial cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179387 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEX6P-1
- Backbone size w/o insert (bp) 4984
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehuman prolyl oligopeptidase
-
Alt namePOP
-
Alt namePREP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2133
-
GenBank IDNM_002726.4
- Promoter TAC
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer GGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX6P1-hPREP was a gift from Christian Gruber (Addgene plasmid # 179387 ; http://n2t.net/addgene:179387 ; RRID:Addgene_179387) -
For your References section:
Discovery of a Beetroot Protease Inhibitor to Identify and Classify Plant-Derived Cystine Knot Peptides. Retzl B, Hellinger R, Muratspahic E, Pinto MEF, Bolzani VS, Gruber CW. J Nat Prod. 2020 Nov 25;83(11):3305-3314. doi: 10.1021/acs.jnatprod.0c00648. Epub 2020 Oct 29. 10.1021/acs.jnatprod.0c00648 PubMed 33118348