pOUPc-Rh159-HA
(Plasmid #179344)

• Purpose: All-in-on "tet-on" 3G lentiviral vector plasmid encoding rhesus cytomegalovirus Rh159 (NK cell evasion protein) with a C-terminal HA tag fused to its cytoplasmic tail
• Depositing Lab: Jeremy Kamil
• Publication: Siddiquey et al J Virol. 2018 Sep 26;92(20). pii: JVI.00896-18. doi: 10.1128/JVI.00896-18. Print 2018 Oct 15.

Backbone

• Vector backbone: pOUPc (modified pInducer20)
• Backbone manufacturer: Steve Elledge
• Backbone size w/o insert (bp): 12096
• Total vector size (bp): 13101
• Vector type: Mammalian Expression, Lentiviral ; all in one tet-on lentiviral vector (HIV-1 based, replication defective)
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Rh159
• Alt name: Rhesus CMV Rh159
• Species: Macacine betaherpesvirus 3 (Rhesus cytomegalovirus)
• Insert Size (bp): 1005
• GenBank ID: NC_006150.1
• Promoter: tet responsive element 3G
• Tag / Fusion Protein:
  • HA tag (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCAGGTAGTGAACCGTCAG
• 3′ sequencing primer: TGATACTGGGGTTCTAAGGC

Resource Information

• Supplemental Documents:
  • pOUPc Rh159HA.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry