pEGFP-hCB2R
(Plasmid
#179322)
-
PurposeExpress human cannabinoid 2 receptor (GFP tagged) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179322 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-N1
- Total vector size (bp) 5781
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehuman cannabinoid 2 receptor
-
Alt nameCB2R
-
Alt nameCNR2
-
SpeciesH. sapiens (human)
-
GenBank IDNM_001841.3 1269
-
Entrez GeneCNR2 (a.k.a. CB-2, CB2, CX5)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GAGGTCTATATAAGCAGAGC
- 3′ sequencing primer ACTTGTGGCCGTTTACGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-hCB2R was a gift from Christian Gruber (Addgene plasmid # 179322 ; http://n2t.net/addgene:179322 ; RRID:Addgene_179322) -
For your References section:
Discovery and development of macrocyclic peptide modulators of the cannabinoid 2 receptor. Tomašević N, Emser FS, Muratspahic E, Gattringer J, Hasinger S, Hellinger R, Keov P, Felkl M, Gertsch J, Becker CFW, Gruber CW. J Biol Chem. 2024 Jun;300(6):107330. doi: 10.1016/j.jbc.2024.107330. Epub 2024 Apr 26. 10.1016/j.jbc.2024.107330 PubMed 38679329