pEGFP-mCCK2R-stop
(Plasmid
#179321)
-
PurposeExpress mouse cholecystokinin 2 receptor (untagged) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179321 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-N1
- Total vector size (bp) 6076
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemouse cholecystokinin2 receptor
-
Alt nameCCK2R
-
Alt nameCCKBR
-
SpeciesM. musculus (mouse)
-
Mutationstop codon after ORF
-
GenBank IDNM_007627
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GAGGTCTATATAAGCAGAGC
- 3′ sequencing primer ACTTGTGGCCGTTTACGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-mCCK2R-stop was a gift from Christian Gruber (Addgene plasmid # 179321 ; http://n2t.net/addgene:179321 ; RRID:Addgene_179321) -
For your References section:
Discovery of the cyclotide caripe 11 as a ligand of the cholecystokinin-2 receptor. Taghizadeh MS, Retzl B, Muratspahic E, Trenk C, Casanova E, Moghadam A, Afsharifar A, Niazi A, Gruber CW. Sci Rep. 2022 Jun 2;12(1):9215. doi: 10.1038/s41598-022-13142-z. 10.1038/s41598-022-13142-z PubMed 35654807