Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEGFP-hMC4R
(Plasmid #179315)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179315 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-N1
  • Total vector size (bp) 5710
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    melanocortin 4 receptor
  • Alt name
    MC4R
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    996
  • GenBank ID
    NM_005912.3
  • Entrez Gene
    MC4R (a.k.a. BMIQ20)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer GAGGTCTATATAAGCAGAGC
  • 3′ sequencing primer ACTTGTGGCCGTTTACGTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-hMC4R was a gift from Christian Gruber (Addgene plasmid # 179315 ; http://n2t.net/addgene:179315 ; RRID:Addgene_179315)
  • For your References section:

    Development of Melanocortin 4 Receptor Agonists by Exploiting Animal-Derived Macrocyclic, Disulfide-Rich Peptide Scaffolds. Muratspahic E, Aslanoglou D, White AM, Draxler C, Kozisek X, Farooq Z, Craik DJ, McCormick PJ, Durek T, Gruber CW. ACS Pharmacol Transl Sci. 2023 Sep 26;6(10):1373-1381. doi: 10.1021/acsptsci.3c00090. eCollection 2023 Oct 13. 10.1021/acsptsci.3c00090 PubMed 37854631