Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

BPK1160
(Plasmid #179298)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179298 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAG-CFP
  • Total vector size (bp) 9925
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9-p65
  • Species
    S. Pyogenes
  • Insert Size (bp)
    5028
  • Mutation
    D10A, H840A (catalytically inactive Cas9)
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer CAGAGGGAAAAAGATCTCAGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BPK1160 was a gift from Keith Joung (Addgene plasmid # 179298 ; http://n2t.net/addgene:179298 ; RRID:Addgene_179298)
  • For your References section:

    Augmenting and directing long-range CRISPR-mediated activation in human cells. Tak YE, Horng JE, Perry NT, Schultz HT, Iyer S, Yao Q, Zou LS, Aryee MJ, Pinello L, Joung JK. Nat Methods. 2021 Sep;18(9):1075-1081. doi: 10.1038/s41592-021-01224-1. Epub 2021 Aug 5. 10.1038/s41592-021-01224-1 PubMed 34354266
Commonly requested with: