Skip to main content
Addgene

pHis6-SUMO-g0s2
(Plasmid #179293)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179293 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET His6 Sumo TEV LIC (2S-T) Addgene # 29711
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 5103
  • Total vector size (bp) 5421
  • Modifications to backbone
    none
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    G0S2
  • Alt name
    G0/G1 switch regulatory protein 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    318
  • Mutation
    full-length G0S2, residues 1-103 from accession number NP_056529.1; optimized DNA sequence
  • GenBank ID
    NP_056529.1
  • Entrez Gene
    G0S2
  • Promoter T7
  • Tag / Fusion Protein
    • His6 + SUMO + TEV protease cleavage site (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SspI (destroyed during cloning)
  • 3′ cloning site SspI (destroyed during cloning)
  • 5′ sequencing primer T7, TAATACGACTCACTATAGGG
  • 3′ sequencing primer T7 Terminal, GCTAGTTATTGCTCAGCGG
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The insert had been ordered from GenScript as an E. coli expression-optimized synthetic DNA.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Protein sequence is MKSS + HHHHHH + GSSMAS + SUMO (aa1-98 of NP_010798.1) + IE + TEV protease cleavage (ENLYFQ*S; * = cleavage site) + N + human G0S2 (G0/G1 switch protein 2; accession number NP_056529.1) + L.
Confers ampicillin-resistance.
Backbone vector is pET His6 Sumo TEV LIC (2S-T) Addgene # 29711.
Construct design by James Zook.
Cloning by Felicia M. Craciunescu and Debra T. Hansen.
Publication: Moran et al 2021 PLoS One 16, e0249164, https://doi.org/10.1371/journal.pone.0249164

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHis6-SUMO-g0s2 was a gift from Debra Hansen (Addgene plasmid # 179293 ; http://n2t.net/addgene:179293 ; RRID:Addgene_179293)

  • For your References section:

    Biophysical characterization and a roadmap towards the NMR solution structure of G0S2, a key enzyme in non-alcoholic fatty liver disease. Moran MW, Ramirez EP, Zook JD, Saarinen AM, Baravati B, Goode MR, Laloudakis V, Kaschner EK, Olson TL, Craciunescu FM, Hansen DT, Liu J, Fromme P. PLoS One. 2021 Jul 14;16(7):e0249164. doi: 10.1371/journal.pone.0249164. eCollection 2021. 10.1371/journal.pone.0249164 PubMed 34260600
Related items: