Skip to main content
Addgene

pHsSyx3-MBP
(Plasmid #179286)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179286 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET MBP His6 LIC (2Cc-T), Addgene # 37237
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 5900
  • Total vector size (bp) 7102
  • Modifications to backbone
    none
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Syx
  • Alt name
    synectin-binding guanine exchange factor
  • Alt name
    pleckstrin homology domain-containing family G member 5 isoform c
  • Alt name
    PLEKHG5; CMTRIC; DSMA4; GEF720; Tech
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1200
  • Mutation
    residues 393-792 from accession number NP_001036128.1; optimized DNA sequence
  • GenBank ID
    NP_001036128.1
  • Promoter T7
  • Tag / Fusion Protein
    • TEV protease cleavage site + mature maltose binding protein + His6 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (destroyed during cloning)
  • 3′ cloning site HpaI (destroyed during cloning)
  • 5′ sequencing primer T7, TAATACGACTCACTATAGGG
  • 3′ sequencing primer 37237 seq R, GTGACTTTAATTCCGGTATCTTTCTCG
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The insert had been ordered from GenScript as an E. coli expression-optimized synthetic DNA.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Protein sequence is Met + human Syx (synectin-binding guanine exchange factor; aa 393-792 from accession number NP_001036128.1) + TEV protease cleavage (ENLYFQ*S; * = cleavage site) + GSSGSM + maltose binding protein (aa 27-393 of AAB59056) + GSS + HHHHHH.
Confers ampicillin-resistance.
Backbone vector is pET MBP His6 LIC (2Cc-T) Addgene # 37237.
Construct design by Ryan Boyd and Debra T. Hansen.
Cloning by Felicia M. Craciunescu.
Preprint: Boyd et al., bioRxiv 2021.08.26.457821, https://doi.org/10.1101/2021.08.26.457821

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHsSyx3-MBP was a gift from Debra Hansen (Addgene plasmid # 179286 ; http://n2t.net/addgene:179286 ; RRID:Addgene_179286)

  • For your References section:

    Characterization and computational simulation of human Syx, a RhoGEF implicated in glioblastoma. Boyd RJ, Olson TL, Zook JD, Stein D, Aceves M, Lin WH, Craciunescu FM, Hansen DT, Anastasiadis PZ, Singharoy A, Fromme P. FASEB J. 2022 Jul;36(7):e22378. doi: 10.1096/fj.202101808RR. 10.1096/fj.202101808RR PubMed 35639414
Related items: