Skip to main content
Addgene

pEGFP-mKOR
(Plasmid #179285)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179285 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-N1
  • Total vector size (bp) 5843
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    kappa opioid receptor
  • Alt name
    KOR
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1141
  • Entrez Gene
    Oprk1 (a.k.a. K-OR-1, KOR, KOR-1, MSL-1, Oprk2, R21)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer GAGGTCTATATAAGCAGAGC
  • 3′ sequencing primer ACTTGTGGCCGTTTACGTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-mKOR was a gift from Christian Gruber (Addgene plasmid # 179285 ; http://n2t.net/addgene:179285 ; RRID:Addgene_179285)
  • For your References section:

    Design of a Stable Cyclic Peptide Analgesic Derived from Sunflower Seeds that Targets the kappa-Opioid Receptor for the Treatment of Chronic Abdominal Pain. Muratspahic E, Tomasevic N, Koehbach J, Duerrauer L, Hadzic S, Castro J, Schober G, Sideromenos S, Clark RJ, Brierley SM, Craik DJ, Gruber CW. J Med Chem. 2021 Jul 8;64(13):9042-9055. doi: 10.1021/acs.jmedchem.1c00158. Epub 2021 Jun 23. 10.1021/acs.jmedchem.1c00158 PubMed 34162205