pOUPc-Rh159-GFP
(Plasmid #179280)

• Purpose: All in one "tet-on" lentivirus vector that expresses rhesus cytomegalovirus Rh159 fused to an eGFP tag at its cytoplasmic tail. Rh159 is an ER resident protein that binds NKG2D activating ligands.
• Depositing Lab: Jeremy Kamil
• Publication: Zhang et al mBio. 2019 Dec 10;10(6). pii: mBio.02110-19. doi: 10.1128/mBio.02110-19.

Backbone

• Vector backbone: pOUPc
• Backbone manufacturer: Steve Elledge lab made pInducer20 from which this was derived
• Backbone size w/o insert (bp): 12092
• Total vector size (bp): 13790
• Modifications to backbone: reverse tet transactivator 3G and TRE 3G
• Vector type: Mammalian Expression, Lentiviral ; all-in-one "tet" on lentiviral vector
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: can be grown 30-32 deg C
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Rh159 fused to eGFP
• Alt name: Rh159
• Species: Macacine betaherpesvirus 3 (Rhesus cytomegalovirus)
• Insert Size (bp): 1698
• GenBank ID: NC_006150
• Promoter: Tet Responsive Element 3G
• Tag / Fusion Protein:
  • eGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: TCAGGTAGTGAACCGTCAG
• 3′ sequencing primer: TGATACTGGGGTTCTAAGGC

Resource Information

• Supplemental Documents:
  • pOUPc-Rh159_eGFP.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry