pOUPc-UL148-mCherry
(Plasmid #179279)

• Purpose: All in one "tet-on" lentivirus vector that expresses human cytomegalovirus UL148 fused to an mCherry tag at its cytoplasmic tail. UL148 reorganizes the ER and activates the UPR.
• Depositing Lab: Jeremy Kamil
• Publication: Zhang et al mBio. 2019 Dec 10;10(6). pii: mBio.02110-19. doi: 10.1128/mBio.02110-19.

Backbone

• Vector backbone: pOUPc
• Backbone manufacturer: derived from Steven Elledge lab's pInducer20
• Backbone size w/o insert (bp): 12126
• Total vector size (bp): 13794
• Vector type: Mammalian Expression, Lentiviral ; tet-on, all-in-one lentiviral vector
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: UL148 fused to mCherry
• Alt name: human cytomegalovirus UL148
• Species: Human herpesvirus 5 (human cytomegalovirus)
• Insert Size (bp): 1668
• GenBank ID: EF999921.1
• Promoter: Tet responsive element 3G
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TCAGGTAGTGAACCGTCAG
• 3′ sequencing primer: TGATACTGGGGTTCTAAGGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry