Skip to main content
Addgene

pBICI_high ori
(Plasmid #179273)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179273 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    self assembled
  • Backbone size w/o insert (bp) 3344
  • Total vector size (bp) 7388
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Use E. coli BL21(DE3) for expression and grow at room temperature.
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Sucrose Phosphorylase from Bifidobacterium adolescentis
  • Alt name
    BaSP
  • Species
    Bifidobacterium adolescentis
  • Insert Size (bp)
    1515
  • GenBank ID
    AF543301.1
  • Entrez Gene
    BAD_RS00415 (a.k.a. BAD_RS00415, BAD_0078)
  • Promoter T7 lacO
  • Tag / Fusion Protein
    • Strep - Tag II (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aacccctcaagacccg
  • 3′ sequencing primer CTGCGCGAAGAAGGCGTG
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Cellobiose phosphorylase from Cellulomonas uda
  • Alt name
    CuCBP
  • Species
    Cellulomonas uda
  • Insert Size (bp)
    2466
  • GenBank ID
    AAQ20920.1
  • Promoter T7 lacO
  • Tag / Fusion Protein
    • His Tag (N terminal on backbone)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer taatacgactcactatagg
  • 3′ sequencing primer CCAAAGTGACCCCGCGTAGCTGC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBICI_high ori was a gift from Bernd Nidetzky (Addgene plasmid # 179273 ; http://n2t.net/addgene:179273 ; RRID:Addgene_179273)

  • For your References section:

    Engineering cascade biocatalysis in whole cells for bottom-up synthesis of cello-oligosaccharides: flux control over three enzymatic steps enables soluble production. Schwaiger KN, Voit A, Wiltschi B, Nidetzky B. Microb Cell Fact. 2022 Apr 9;21(1):61. doi: 10.1186/s12934-022-01781-w. 10.1186/s12934-022-01781-w PubMed 35397553
Related items: