Skip to main content
Addgene

CcCDP_p15A
(Plasmid #179272)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179272 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    self assembled
  • Backbone size w/o insert (bp) 3102
  • Total vector size (bp) 6093
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Expression in BL21(DE3), expression at room temperature (25°C)
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    cellodextrin phosphorylase
  • Species
    Clostridium cellulosi
  • Insert Size (bp)
    2991
  • GenBank ID
    CDZ24361.1 CDZ24361.1
  • Promoter T7 lacO
  • Tag / Fusion Protein
    • 6xHIS (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGACAACATCCTGGAAGCG
  • 3′ sequencing primer GGGTGTCAACCATAATGCCG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CcCDP_p15A was a gift from Bernd Nidetzky (Addgene plasmid # 179272 ; http://n2t.net/addgene:179272 ; RRID:Addgene_179272)

  • For your References section:

    Engineering cascade biocatalysis in whole cells for bottom-up synthesis of cello-oligosaccharides: flux control over three enzymatic steps enables soluble production. Schwaiger KN, Voit A, Wiltschi B, Nidetzky B. Microb Cell Fact. 2022 Apr 9;21(1):61. doi: 10.1186/s12934-022-01781-w. 10.1186/s12934-022-01781-w PubMed 35397553
Related items: