pLKO.1 shFEN
(Plasmid
#17921)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 17921 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO.1 puro
- Backbone size w/o insert (bp) 7200
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshFEN
-
Alt nameFEN1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)50
-
Entrez GeneFEN1 (a.k.a. FEN-1, MF1, RAD2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Age1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer NA (Common Sequencing Primers)
Resource Information
-
Reference
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Target sequence: TCACTAAGCAGCACAATGAT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1 shFEN was a gift from Sheila Stewart (Addgene plasmid # 17921 ; http://n2t.net/addgene:17921 ; RRID:Addgene_17921) -
For your References section:
Flap endonuclease 1 contributes to telomere stability. Saharia A, Guittat L, Crocker S, Lim A, Steffen M, Kulkarni S, Stewart SA. Curr Biol. 2008 Apr 8. 18(7):496-500. 10.1016/j.cub.2008.02.071 PubMed 18394896