pAd5-B6/7 ∆E3-GFP
(Plasmid #179202)

• Purpose: A block for the AdenoBuilder genome assembly system. The insert consolidates the regions present in pAd5-B6∆E3-GFP and pAd5-B7.
• Depositing Lab: Fred Bunz
• Publication: Jang et al STAR Protoc. 2022 Jan 20;3(1):101123. doi: 10.1016/j.xpro.2022.101123. eCollection 2022 Mar 18.

Backbone

• Vector backbone: pJet1.2
• Backbone manufacturer: ThermoFisher Scientific
• Backbone size w/o insert (bp): 2988
• Total vector size (bp): 12877
• Vector type: Adenoviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Modified block 6/7, with deletion in E3 and insertion of GFP cassette
• Species: Adenovirus 5
• Insert Size (bp): 9889
• GenBank ID: NC_001405

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRV (unknown if destroyed)
• 3′ cloning site: EcoRV (unknown if destroyed)
• 5′ sequencing primer: CGACTCACTATAGGGAGAGCGGC
• 3′ sequencing primer: AAGAACATCGATTTTCCATGGCAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry