pMC_MS2_DNA_VLP
(Plasmid #179156)

• Purpose: Expression of maturation protein and his-tagged coat protein dimer from MS2 phage
• Depositing Lab: Paul Freemont
• Publication: Crone et al GEN Biotechnol. 2022 Dec 1;1(6):496-503. doi: 10.1089/genbio.2022.0033. Epub 2022 Dec 21.

Backbone

• Vector backbone: pMX
• Backbone manufacturer: ThermoFisher Scientific
• Backbone size w/o insert (bp): 2353
• Total vector size (bp): 4466
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Maturation Protein
• Alt name: A-Protein
• Species: MS2 Phage
• Insert Size (bp): 1182
• Promoter: T7

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: AGGGTTTTCCCAGTCACGACGTT
• 3′ sequencing primer: CAGGAAACAGCTATGACC

Gene/Insert 2

• Gene/Insert name: Coat Protein Dimer
• Species: Synthetic
• Insert Size (bp): 801
• Promoter: T7

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: AGGGTTTTCCCAGTCACGACGTT
• 3′ sequencing primer: CAGGAAACAGCTATGACC

Resource Information

• Supplemental Documents:
  • pmc_ms2_dna_vlp.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • OpenMTA
• Industry Terms:
  • OpenMTA

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2022.09.04.506540 for bioRxiv preprint.