Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

GA_HBV_MS2_(AmpR)
(Plasmid #179155)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 179155 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pMX
  • Backbone manufacturer
    ThemoFisher Scientific
  • Backbone size w/o insert (bp) 2353
  • Total vector size (bp) 4148

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    XCS Gene
  • Species
    Hepatitis B Virus
  • Insert Size (bp)
    1795
  • GenBank ID
  • Promoter T7

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AGGGTTTTCCCAGTCACGACGTT
  • 3′ sequencing primer CAGGAAACAGCTATGACC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Received from GeneArt as a synthesised product.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GA_HBV_MS2_(AmpR) was a gift from Paul Freemont (Addgene plasmid # 179155 ; http://n2t.net/addgene:179155 ; RRID:Addgene_179155)
  • For your References section:

    Simple Low-Cost Production of DNA MS2 Virus-Like Particles As Molecular Diagnostic Controls. Crone MA, Freemont PS. GEN Biotechnol. 2022 Dec 1;1(6):496-503. doi: 10.1089/genbio.2022.0033. Epub 2022 Dec 21. 10.1089/genbio.2022.0033 PubMed 36644571