pCAG-hPPP3R1
(Plasmid #179136)

• Purpose: Expression vector of human protein phosphatase 3, regulatory subunit B, alpha isoform (PPP3R1), CAG promoter, rabbit globin poly(A) signal.
• Depositing Lab: Masahito Ikawa
• Publication: Miyata et al Proc Natl Acad Sci U S A. 2021 Aug 31;118(35). pii: 2106673118. doi: 10.1073/pnas.2106673118.

Backbone

• Vector backbone: pCAG1.1
• Backbone size w/o insert (bp): 5142
• Total vector size (bp): 5661
• Modifications to backbone: pCAGGS was used as an original vector.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: protein phosphatase 3, regulatory subunit B, alpha isoform
• Alt name: PPP3R1
• Species: H. sapiens (human)
• Insert Size (bp): 519
• Entrez Gene: PPP3R1 (a.k.a. CALNB1, CNB, CNB1)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: GCCTTCTTCTTTTTCCTACAGC
• 3′ sequencing primer: GCCACACCAGCCACCACCTTCTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry