pCAG-hPPP3CB-FLAG
(Plasmid #179135)

• Purpose: Expression vector of human protein phosphatase 3, catalytic subunit, beta isoform (PPP3CB) tagged with FLAG at C-terminus, CAG promoter, rabbit globin poly(A) signal.
• Depositing Lab: Masahito Ikawa
• Publication: Miyata et al Proc Natl Acad Sci U S A. 2021 Aug 31;118(35). pii: 2106673118. doi: 10.1073/pnas.2106673118.

Backbone

• Vector backbone: pCAG1.1
• Backbone size w/o insert (bp): 5175
• Total vector size (bp): 6789
• Modifications to backbone: pCAGGS was used as an original vector. FLAG sequence was added.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: protein phosphatase 3, catalytic subunit, beta isoform
• Alt name: PPP3CB
• Species: H. sapiens (human)
• Insert Size (bp): 1614
• Entrez Gene: PPP3CB (a.k.a. CALNA2, CALNB, CNA2, PP2Bbeta)
• Tag / Fusion Protein:
  • FLAG (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: EcoRV (not destroyed)
• 5′ sequencing primer: GCCTTCTTCTTTTTCCTACAGC
• 3′ sequencing primer: GCCACACCAGCCACCACCTTCTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry