pCAG-hSPATA33-8xHIS-1D4
(Plasmid
#179133)
-
PurposeExpression vector of human spermatogenesis associated 33 (SPATA33) tagged with 8XHIS and 1D4 at C-terminus, CAG promoter, rabbit globin poly(A) signal.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179133 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAG1.1
- Backbone size w/o insert (bp) 5232
- Total vector size (bp) 5661
-
Modifications to backbonepCAGGS was used as an original vector. 8XHIS and 1D4 sequences were added.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namespermatogenesis associated 33
-
Alt nameSPATA33
-
SpeciesH. sapiens (human)
-
Insert Size (bp)429
-
Entrez GeneSPATA33 (a.k.a. C16orf55)
-
Tags
/ Fusion Proteins
- 8XHIS (C terminal on backbone)
- 1D4 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCCTTCTTCTTTTTCCTACAGC
- 3′ sequencing primer GCCACACCAGCCACCACCTTCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-hSPATA33-8xHIS-1D4 was a gift from Masahito Ikawa (Addgene plasmid # 179133 ; http://n2t.net/addgene:179133 ; RRID:Addgene_179133) -
For your References section:
SPATA33 localizes calcineurin to the mitochondria and regulates sperm motility in mice. Miyata H, Oura S, Morohoshi A, Shimada K, Mashiko D, Oyama Y, Kaneda Y, Matsumura T, Abbasi F, Ikawa M. Proc Natl Acad Sci U S A. 2021 Aug 31;118(35). pii: 2106673118. doi: 10.1073/pnas.2106673118. 10.1073/pnas.2106673118 PubMed 34446558