Skip to main content
Addgene

pCAG-mSpata33-PA
(Plasmid #179129)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179129 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAG1.1
  • Backbone size w/o insert (bp) 5211
  • Total vector size (bp) 5613
  • Modifications to backbone
    pCAGGS was used as an original vector. PA sequence was added.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    spermatogenesis associated 33
  • Alt name
    Spata33
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    402
  • Entrez Gene
    Spata33 (a.k.a. 4732415M23Rik, AI847264)
  • Tag / Fusion Protein
    • PA (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer GCCTTCTTCTTTTTCCTACAGC
  • 3′ sequencing primer GCCACACCAGCCACCACCTTCTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-mSpata33-PA was a gift from Masahito Ikawa (Addgene plasmid # 179129 ; http://n2t.net/addgene:179129 ; RRID:Addgene_179129)
  • For your References section:

    SPATA33 localizes calcineurin to the mitochondria and regulates sperm motility in mice. Miyata H, Oura S, Morohoshi A, Shimada K, Mashiko D, Oyama Y, Kaneda Y, Matsumura T, Abbasi F, Ikawa M. Proc Natl Acad Sci U S A. 2021 Aug 31;118(35). pii: 2106673118. doi: 10.1073/pnas.2106673118. 10.1073/pnas.2106673118 PubMed 34446558