Skip to main content
Addgene

Pzac2.1 U6-Ezr sgRNA1, 2, 3_gfaABC1D mcherry SV40
(Plasmid #179119)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179119 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    PZac2.1
  • Backbone manufacturer
    Khakh lab
  • Backbone size w/o insert (bp) 5206
  • Total vector size (bp) 6288
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ezr sgRNA
  • gRNA/shRNA sequence
    25, 26, 26
  • Species
    Synthetic
  • Promoter U6

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer tgctctaggaagatc
  • 3′ sequencing primer agctcacagagccagctcag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Pzac2.1 U6-Ezr sgRNA1, 2, 3_gfaABC1D mcherry SV40 was a gift from Baljit Khakh (Addgene plasmid # 179119 ; http://n2t.net/addgene:179119 ; RRID:Addgene_179119)
  • For your References section:

    Molecular basis of astrocyte diversity and morphology across the CNS in health and disease. Endo F, Kasai A, Soto JS, Yu X, Qu Z, Hashimoto H, Gradinaru V, Kawaguchi R, Khakh BS. Science. 2022 Nov 4;378(6619):eadc9020. doi: 10.1126/science.adc9020. Epub 2022 Nov 4. 10.1126/science.adc9020 PubMed 36378959