Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTU422
(Plasmid #178982)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178982 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p13S-S
  • Backbone size w/o insert (bp) 4021
  • Total vector size (bp) 9977
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    gRAMP
  • Species
    Candidatus Scalindua brodae
  • Insert Size (bp)
    5169
  • Promoter T7
  • Tag / Fusion Protein
    • Strep-Tag II SUMO (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    CRISPR array
  • Species
    Candidatus Scalindua brodae
  • Insert Size (bp)
    787
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAACGTGATGGTAAAATGG
  • 3′ sequencing primer ACAATTCGTTCAAGCCGAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTU422 was a gift from Stan Brouns (Addgene plasmid # 178982 ; http://n2t.net/addgene:178982 ; RRID:Addgene_178982)
  • For your References section:

    The gRAMP CRISPR-Cas effector is an RNA endonuclease complexed with a caspase-like peptidase. van Beljouw SPB, Haagsma AC, Rodriguez-Molina A, van den Berg DF, Vink JNA, Brouns SJJ. Science. 2021 Sep 17;373(6561):1349-1353. doi: 10.1126/science.abk2718. Epub 2021 Aug 26. 10.1126/science.abk2718 PubMed 34446442