Skip to main content
Addgene

PZac2.1 gfaABC1D-NLS-SaCas9-3xHA-NLS bGH
(Plasmid #178960)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178960 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    PZac2.1
  • Backbone manufacturer
    Khakh lab
  • Backbone size w/o insert (bp) 3861
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Staphylococcus aureus Cas9 (SaCas9)
  • Alt name
    SaCas9
  • Species
    Staphylococcus aureus
  • Insert Size (bp)
    3340
  • Promoter gfaABC1D (astrocyte specific)
  • Tag / Fusion Protein
    • 3x HA (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ggcctctagactcgagaacatatcctggtgtggagtaggg
  • 3′ sequencing primer acctccgctgctcgcaccggtgccaccatgg
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PZac2.1 gfaABC1D-NLS-SaCas9-3xHA-NLS bGH was a gift from Baljit Khakh (Addgene plasmid # 178960 ; http://n2t.net/addgene:178960 ; RRID:Addgene_178960)

  • For your References section:

    Molecular basis of astrocyte diversity and morphology across the CNS in health and disease. Endo F, Kasai A, Soto JS, Yu X, Qu Z, Hashimoto H, Gradinaru V, Kawaguchi R, Khakh BS. Science. 2022 Nov 4;378(6619):eadc9020. doi: 10.1126/science.adc9020. Epub 2022 Nov 4. 10.1126/science.adc9020 PubMed 36378959
Related items:
Commonly requested with: