pJH1579
(Plasmid #178904)

• Purpose: Pglr-1::YC3.60 unc-54 3' UTR C.elegans neural expression of Pglr-1 YC3.60
• Depositing Lab: Mei Zhen
• Publication: Kawano et al Neuron. 2011 Nov 17;72(4):572-86. doi: 10.1016/j.neuron.2011.09.005.

Backbone

• Vector backbone: pBSK
• Backbone manufacturer: stratagene
• Backbone size w/o insert (bp): 9215
• Total vector size (bp): 12037
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: YC3.60
• Insert Size (bp): 2822
• Mutation: See Depositor Comments Below
• GenBank ID:
• Promoter: Pglr-1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EagI (not destroyed)
• 5′ sequencing primer: CCCCCGGGCcATGGTGAGCAAGGG
• 3′ sequencing primer: GCGATCTGATGACAGCGGCCGATG

Resource Information

• Supplemental Documents:
  • pJH1579.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

Please note: Plasmid contains N165H and K213N mutations in YC3.60 and has a Ser3 deletion in Cerulean. These mutations are not known to affect plasmid function.