Skip to main content
Addgene

pGLOW63
(Plasmid #178877)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178877 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC19 (modified)
  • Backbone size w/o insert (bp) 3881
  • Total vector size (bp) 9676
  • Modifications to backbone
    Addition of ccdB markers to facilitate homology arm cloning
  • Vector type
    Worm Expression, Cre/Lox, CRISPR
  • Selectable markers
    Hygromycin ; sqt-1(d) (worm phenotypic marker)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Turbo
  • Growth instructions
    The dual ccdB sites in this vector may make it prone to recombination. It is recommended to pick several single clones and check test by restriction digestion before use. This construct should be maintained as a purified plasmid stock in addition to a bacterial stock in case there is a need to re-transform.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    wrmScarlet11^SEC^3xMyc
  • Species
    C. elegans (nematode), Synthetic
  • Insert Size (bp)
    5795
  • Mutation
    Added ATG start codon to wrmScarlet11 sequence for N-terminal tags
  • Tags / Fusion Proteins
    • wrmScarlet11
    • 3xMyc

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer attaagttgggtaacgccagg
  • 3′ sequencing primer gtggaattgtgagcggataac
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Derived from pGLOW39 (Addgene #173068)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The split-wrmScarlet system was developed and published by Goudeau et al. Genetics 2021. pGLOW63 is a derivative of published TagRFP-SEC vectors (Dickinson et al. Genetics 2015). It has a 3xMyc tag in place of 3xFlag and Lox2272 sites in place of LoxP. These features allow pGLOW63 to be used in a genetic background that has already been modified using a green FP-SEC vector, without conflicts between epitope tags and Lox sites. pGLOW63 must also be used in a genetic background that has wrmScarlet1-10. Made by Amelie Perez (Glow Worms '21).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGLOW63 was a gift from Ryan Doonan (Addgene plasmid # 178877)

  • For your References section:

    mScarlet and split fluorophore mScarlet resources for plasmid-based CRISPR/Cas9 knock-in in C. elegans. Witten G, DeMott E, Huang G, Zelasko F, de Jesus B, Mulchand C, Schuck L, Pullman S, Perez A, Mahableshwarkar P, Wu Z, Cardona EA, Pierce JT, Dickinson DJ, Doonan R. MicroPubl Biol. 2023 Jun 14;2023:10.17912/micropub.biology.000871. doi: 10.17912/micropub.biology.000871. eCollection 2023. 10.17912/micropub.biology.000871 PubMed 37396790
Related items: