pHN764
(Plasmid
#178819)
-
PurposeExpression of EndoH in E. coli
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 178819 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMal_c2
-
Backbone manufacturerNEB
- Total vector size (bp) 7480
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesynthetic gene encoding endo-β-N-acetylglucosaminidase H
-
Alt nameEndoH
-
SpeciesStreptomyces sp.
-
Insert Size (bp)816
- Promoter tac
-
Tags
/ Fusion Proteins
- MBP (N terminal on backbone)
- HIs8 (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GATGAAGCCCTGAAAGACGCGC
- 3′ sequencing primer CGCCAGGGTTTTCCCAGTCACGAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHN764 was a gift from Kazuhiro Abe (Addgene plasmid # 178819 ; http://n2t.net/addgene:178819 ; RRID:Addgene_178819)