PX459v3-SpCas9-HF1
(Plasmid
#178801)
-
Purpose(Empty Backbone) High-fidelity SpCas9-HF1 with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178801 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepX459V2.0-SpCas9-HF1 (Plasmid #108293)
-
Backbone manufacturerDr. Yuichiro Miyaoka's Lab
- Backbone size (bp) 9175
-
Modifications to backbonegRNA scaffold sequence modified for increased gRNA expression (V3 Scaffold)
-
Vector typeMammalian Expression, CRISPR
- Promoter Cbh (Cas9-2A Puro) and U6 (gRNA)
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GGTTTCGCCACCTCTGACTTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.07.19.604224 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX459v3-SpCas9-HF1 was a gift from Paul Thomas (Addgene plasmid # 178801 ; http://n2t.net/addgene:178801 ; RRID:Addgene_178801) -
For your References section:
Enhancing gRNA Transcript levels by Reducing the Scaffold Poly-T Tract for Optimal SpCas9- and SaCas9-mediated Gene Editing. Chey YCJ, Gierus L, Lushington C, Arudkumar JC, Geiger A, Staker LG, Robertson LJ, Pfitzner C, Kennedy JG, Lee RHB, Godahewa GI, Thomas PQ, Adikusuma F. bioRxiv 2024.07.19.604224 10.1101/2024.07.19.604224
