pCAG-postASAP-p2a-ChrimsonR
(Plasmid
#178794)
-
PurposeExpresses voltage sensor targeted to dendrites and spines along with ChrimsonR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 178794 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 6097
- Total vector size (bp) 9502
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFingR.PSD95, ASAP2f and ChrimsonR
-
Alt nameaccelerated sensor of action potentials 2f
-
SpeciesSynthetic
-
Insert Size (bp)4076
-
Mutationmutations in amino acids L146G, S147T N149R, S150G, H151D, T399R of ASAP2f
- Promoter CAG
-
Tag
/ Fusion Protein
- mRuby2
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cttgaagtggtaaccggctccggagcc
- 3′ sequencing primer taccaagctttcattacttgtacagctcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-postASAP-p2a-ChrimsonR was a gift from Rafael Yuste (Addgene plasmid # 178794 ; http://n2t.net/addgene:178794 ; RRID:Addgene_178794) -
For your References section:
Voltage compartmentalization in dendritic spines in vivo. Cornejo VH, Ofer N, Yuste R. Science. 2022 Jan 7;375(6576):82-86. doi: 10.1126/science.abg0501. Epub 2021 Nov 11. 10.1126/science.abg0501 PubMed 34762487