Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

myristoylated ct-GRK2
(Plasmid #178734)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178734 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFUGW
  • Backbone size w/o insert (bp) 9173
  • Total vector size (bp) 9572
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GRK2
  • Alt name
    ADRBK1
  • Alt name
    BARK1
  • Alt name
    BETA-ARK1
  • Species
    B. taurus (bovine)
  • Insert Size (bp)
    426
  • Mutation
    only amino acids 548-671
  • Entrez Gene
    GRK2 (a.k.a. ADRBK1)
  • Promoter Ubiquitin
  • Tag / Fusion Protein
    • Src 1-15 (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aatttgtccgctaaattctggccg
  • 3′ sequencing primer gtggatacgctgctttaatgcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    myristoylated ct-GRK2 was a gift from Ege Kavalali (Addgene plasmid # 178734 ; http://n2t.net/addgene:178734 ; RRID:Addgene_178734)
  • For your References section:

    Presynaptic mechanisms underlying GABA(B)-receptor-mediated inhibition of spontaneous neurotransmitter release. Alten B, Guzikowski NJ, Zurawski Z, Hamm HE, Kavalali ET. Cell Rep. 2022 Jan 18;38(3):110255. doi: 10.1016/j.celrep.2021.110255. 10.1016/j.celrep.2021.110255 PubMed 35045279