myristoylated ct-GRK2
(Plasmid #178734)

• Purpose: N-myristoylation signaling peptide of Src and the C-terminal fragment of G-protein coupled receptor kinase 2 (ct-GRK2)
• Depositing Lab: Ege Kavalali
• Publication: Alten et al Cell Rep. 2022 Jan 18;38(3):110255. doi: 10.1016/j.celrep.2021.110255.

Backbone

• Vector backbone: pFUGW
• Backbone size w/o insert (bp): 9173
• Total vector size (bp): 9572
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GRK2
• Alt name: ADRBK1
• Alt name: BARK1
• Alt name: BETA-ARK1
• Species: B. taurus (bovine)
• Insert Size (bp): 426
• Mutation: only amino acids 548-671
• Entrez Gene: GRK2 (a.k.a. ADRBK1)
• Promoter: Ubiquitin
• Tag / Fusion Protein:
  • Src 1-15 (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: aatttgtccgctaaattctggccg
• 3′ sequencing primer: gtggatacgctgctttaatgcc

Resource Information

• Supplemental Documents:
  • pkamo005.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry