AAV-hGFAP-mCherry-shLuci
(Plasmid
#178588)
-
PurposeExpression of mCherry and a shRNA against luciferase under the human GFAP promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 178588 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiRE-Luciferase
-
gRNA/shRNA sequenceTAGATAAGCATTATAATTCCTA
-
SpeciesOther
-
Insert Size (bp)1200
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-hGFAP-mCherry-shLuci was a gift from Chun-Li Zhang (Addgene plasmid # 178588 ; http://n2t.net/addgene:178588 ; RRID:Addgene_178588) -
For your References section:
Revisiting astrocyte to neuron conversion with lineage tracing in vivo. Wang LL, Serrano C, Zhong X, Ma S, Zou Y, Zhang CL. Cell. 2021 Oct 14;184(21):5465-5481.e16. doi: 10.1016/j.cell.2021.09.005. Epub 2021 Sep 27. 10.1016/j.cell.2021.09.005 PubMed 34582787