Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAV-hGFAP-mCherry-shLuci
(Plasmid #178588)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178588 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miRE-Luciferase
  • gRNA/shRNA sequence
    TAGATAAGCATTATAATTCCTA
  • Species
    Other
  • Insert Size (bp)
    1200

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-hGFAP-mCherry-shLuci was a gift from Chun-Li Zhang (Addgene plasmid # 178588 ; http://n2t.net/addgene:178588 ; RRID:Addgene_178588)
  • For your References section:

    Revisiting astrocyte to neuron conversion with lineage tracing in vivo. Wang LL, Serrano C, Zhong X, Ma S, Zou Y, Zhang CL. Cell. 2021 Oct 14;184(21):5465-5481.e16. doi: 10.1016/j.cell.2021.09.005. Epub 2021 Sep 27. 10.1016/j.cell.2021.09.005 PubMed 34582787